Интеллектуальная собственность

Расширенный поиск
Вид ИС
Предметная область
Сдобное овсяное печенье на растительных маслах и молочной сыворотке / RU 02723961 C1 20200618/
Открыть
Описание
Изобретение относится к кондитерской отрасли. Предложен способ производства сдобного овсяного печенья, предусматривающий приготовление белок-полисахаридной смеси (БПС) из агара, альгината натрия, натрий-карбоксиметилцеллюлозы (Na-КМЦ) и сухой молочной сыворотки, добавление к смеси горячей воды с температурой 60-90°С, перемешивание и набухание смеси в течение 40-60 минут, сбивание БПС, введение жидкого растительного масла и сбивание в течение 8-10 минут с получением эмульсии, после чего вводят в полученную эмульсию вкусоароматические добавки, представляющие собой по меньшей мере одно из изюма, повидла, патоки и корицы, и смесь сахарозаменителей из изомальтита, сорбита и ксилита и тщательно перемешивают, в полученную смесь вносят овсяную муку, муку рисовую, смесь картофельного и кукурузного крахмалов, соль, соду и замешивают тесто, полученное тесто направляют на формование, выпечку и последующее охлаждение, при следующем соотношение исходных компонентов, мас. ч.: мука овсяная 145-175; мука рисовая 30-120; крахмал картофельный 120-215; крахмал кукурузный 110-175; изомальтит 220-280; сорбит 27-35; ксилит 27-35; жидкое растительное масло 130-200; соль 3,5-4,5; сода 5-8; вкусоароматические добавки 60-100; сухая молочная сыворотка 15-35; альгинат натрия 0,20-0,50; агар 0,20-0,50; натрий-карбоксиметилцеллюлоза 0,18-0,36; вода для БПС 120-170. При этом растительное масло выбирают из подсолнечного, кунжутного, рапсового, льняного, масла грецкого ореха и их смесей. Изобретение направлено на получение сдобного овсяного печенья диабетической направленности и для людей с целиакией на жидких растительных маслах при сохранении традиционных органолептических характеристик. 1 з.п. ф-лы, 1 ил., 3 табл., 9 пр. Подробнее
Дата
2019-12-30
Патентообладатели
Васькина Валентина Андреевна
Авторы
Васькина Валентина Андреевна , Бабаева Дарья Сергеевна , Соколова Надежда Дмитриевна , Саломатов Алексей Сергеевич , Щербакова Елена Ивановна , Двоеглазова Анастасия Александровна , Дубцова Галина Николаевна , Мухамедиев Шамиль Ахмедович
Рекомбинантный белок GBD-SSTad-SSTad, способ его получения и применения / RU 02722849 C1 20200604/
Открыть
Описание
Настоящее изобретение относится к генной инженерии, биотехнологии, иммунологии, микробиологии. Описан рекомбинантный белок GBD-SSTad-SSTad и способ его получения на глюкане, включающему связывание белка GBD-SSTad-SSTad в составе клеточных экстрактов штамма Е. coli BL21 [pGBD-SSTad-SSTad] с альфа-гликансодержащим сорбентом за счет аффинного взаимодействия при процедуре инкубации, последующую отмывку от не связавшихся бактериальных белков и выделение целевого продукта. Изобретение также относится к иммуногенной композиции и набору, содержащему указанный пептид. Изобретение также касается использования полученного белка для увеличения количества созревающих фолликул и улучшению качественных показателей спермы. Данный технический результат - увеличение количества созревающих фолликул и улучшение качественных показателей спермы основан на использовании пептида KNFFWKTFTS, который входит в состав рекомбинантного белка, который способен формировать аутоантитела к соматостатину. Таким образом, изобретение может применяться для лечения мужского и женского бесплодия. При этом белок по изобретению иммунологически активен, легко поддается очистке. Изобретение реализовано путем создания рекомбинантного белка, включающего две антигенных детерминанты соматостатина и глюкансвязывающий домен. Разработан способ получения целевого белка на глюкане, который включает в себя связывание белка с глюкансодержащим сорбентом за счет аффинного взаимодействия, последующую отмывку от несвязавшихся бактериальных белков и выделение целевого продукта. Реализация изобретения заключается также в получении инъекционного препарата на основе указанного белка и в создании метода использования этого препарата, включающего проведение подкожных или внутримышечных инъекций препарата, решающего задачу усиления фолликуло- и спермогенеза у млекопитающих животных, птицы и человека. 4 н. и 2 з.п. ф-лы, 2 ил., 9 табл., 9 пр. Подробнее
Дата
2019-12-25
Патентообладатели
Лунин Владимир Глебович , Юдин Сергей Михайлович
Авторы
Лунин Владимир Глебович , Юдин Сергей Михайлович , Решетник Вячеслав Викторович , Магатаев Вали-Магомед Кадиевич
Диетический кремовый полуфабрикат / RU 02724689 C1 20200625/
Открыть
Описание
Изобретение относится к пищевой промышленности, а именно к производству специализированных пищевых продуктов диетического питания. Диетический кремовый полуфабрикат характеризуется тем, что он включает жировую фазу, содержание которой составляет 10-39 мас. %, в качестве которой используют растительные масла, молочный и/или растительный белок, натуральные сахарозаменители, воду и пищевые волокна, в качестве которых используют бета-глюкан, и/или инулин, и/или арабиногалактан, в количестве 1-10 г на 100 ккал полуфабриката. Изобретение позволяет улучшение показателей диетического кремового полуфабриката, снизить калорийность кремового полуфабриката, повысить его пищевую ценность, а также позволяет использовать полученный продукт для питания людей страдающих диабетом и ожирением. 6 з.п. ф-лы, 1 табл., 7 пр. Подробнее
Дата
2019-11-26
Патентообладатели
Спирюгов Александр Николаевич
Авторы
Спирюгов Александр Николаевич , Зайцева Лариса Валентиновна , Рубан Наталья Викторовна , Кравченко Вячеслав Сергеевич , Рубан Дарина Игоревна
ПОЛИАНТИГЕННАЯ ВАКЦИНА ДЛЯ ПРОФИЛАКТИКИ И ВСПОМОГАТЕЛЬНОГО ЛЕЧЕНИЯ ТУБЕРКУЛЕЗА / RU 02724896 C1 20200626/
Открыть
Описание
Изобретение относится к области медицины и фармацевтики и представляет собой рекомбинантную противотуберкулезную вакцину, содержащую эффективное количество рекомбинантного белка ESAT6-CFP10-Ag85a-Rv2660c, который представляет собой слитые микобактериальные белки ESAT-6, CFP10, Ag85a, Rv2660c с гистидиновым тагом длиной 8 остатков, и адъювант, представленный CPG-олигонуклеотидом и мурамилдипептидом, причем рекомбинантный белок и адъювант иммобилизованы на частицах носителя из сополимера молочной и гликолевой кислот PLGA. Технический результат заключается в повышенном иммуногенном действии рекомбинантного белка-антигена ESAT6-CFP10-Ag85a-Rv2660c в сочетании с адъювантом, представленным CpG-ODN класса А и N-ацетилмурамил-L-аланил-D-изоглутамином. 4 з.п. ф-лы, 13 ил., 10 табл., 7 пр. Подробнее
Дата
2019-11-14
Патентообладатели
"федеральное государственное бюджетное учреждение ""Национальный исследовательский центр эпидемиологии и микробиологии имени почетного академика Н.Ф. Гамалеи"" Министерства здравоохранения Российской Федерации "
Авторы
Гущин Владимир Алексеевич , Ткачук Артем Петрович , Гинцбург Александр Леонидович , Логунов Денис Юрьевич , Тухватулин Амир Ильдарович , Васина Дарья Владимировна , Ерохова Алина Сергеевна , Джаруллаева Алина Шахмировна , Ремизов Тимофей Андреевич , Мануйлов Виктор Александрович
Модифицированные ДНК-аптамеры, связывающие внеклеточный домен EGFR / RU 02723398 C1 20200611/
Открыть
Описание
Изобретение относится к области биотехнологии. Изобретение представляет собой способ получения новых ДНК-аптамеров к EGFR (epidermal growth factor receptor, рецептор эпидермального фактора роста), узнающих внеклеточный домен белка и содержащих химически модифицированный нуклеотид. В изобретении описаны аптамерные дезоксирибоолигонуклеотиды, специфически связывающиеся с EGFR и характеризующиеся нуклеотидной последовательностью общей формулы ACGCACCATTTGTTTAATATGXTTTTTAATXCCCCTTGTGGTGTGT, где X - либо тимидин, либо 5-(1-(пропиламид 4-пиренбутановой кислоты)-4-триазолил)дезоксирибоуридин, причем модифицированный нуклеотид присутствует в олигонуклеотиде только в одном из положений. Разработанные аптамеры обладают улучшенной аффинностью к белку EGFR человека и к его мутантной форме EGFR vIII. 6 н.п. ф-лы, 7 ил., 3 пр. Подробнее
Дата
2019-10-31
Патентообладатели
"Общество с ограниченной ответственностью ""АПТО-ФАРМ"" "
Авторы
Копылов Алексей Михайлович , Головин Андрей Викторович , Павлова Галина Валериевна , Завьялова Елена Геннадиевна , Турашев Аскар Дамирович , Антипова Ольга Михайловна , Бабий Владимир Евстахиевич , Новосельцева Анастасия Александровна
Штамм рекомбинантной псевдоаденовирусной частицы, экспрессирующий химерный ген MBL-CT666 Chlamydia trachomatis, способ его получения, иммуногенная композиция для защиты от урогенитального хламидиоза человека / RU 02721123 C1 20200518/
Открыть
Описание
Изобретение относится к области биотехнологии и касается штамма рекомбинантной псевдоаденовирусной частицы, экспрессирующего химерный ген MBL-CT666 Chlamydia trachomatis после его введения в организм субъекта. Получен штамм рекомбинантной псевдоаденовирусной частицы, экспрессирующий химерный ген MBL-CT666 Chlamydia trachomatis, несущий в составе экспрессирующей конструкции нуклеотидную последовательность SEQ ID NO: 1 химерного гена MBL-CT666 Chlamydia trachomatis, который после введения в организм субъекта продуцирует химерный белок MBL-CT666 Chlamydia trachomatis в виде аминокислотной последовательности SEQ ID NO: 2, индуцирующий защиту от урогенитального хламидиоза человека. Способ получения штамма рекомбинантной псевдоаденовирусной частицы, экспрессирующего химерный ген MBL-CT666 Chlamydia trachomatis, заключается в том, что штамм получают путем гомологичной рекомбинации в клетках E. coli штамма BJ5183 между плазмидой pShuttle-CMV (#240007 , pShuttle-CMV vector, Agilent, US), несущей кассету с химерным геном MBL-CT666 Chlamydia trachomatis, переклонированным из плазмиды pAL2-T, и ДНК аденовируса человека 5 серотипа с делецией в области E1 и Е3 генома аденовируса, причем сборку рекомбинантных псевдоаденовирусных наночастиц проводят в клетках линии HEK293, Human embryonic kidney 293, после трансфекции рекомбинантной ДНК pAd-MBL-CT666, при этом в результате конструирования экспрессирующая кассета содержит CMV-промотор цитомегаловируса человека, целевой ген - химерный ген MBL-CT666 Chlamydia trachomatis, пА-сигнал полиаденилирования и находится в области делеции E1 генома аденовируса, при этом используют полимеразную цепную реакцию со специфическими праймерами, получена иммуногенная композиция, содержащая штамм рекомбинантной псевдоаденовирусной частицы, экспрессирующий химерный ген MBL-CT666 Chlamydia trachomatis, для применения в количестве не менее 2×108 БОЕ/мл, при этом она содержит фармацевтически приемлемый буферный раствор до 0,5-1,0 мл, объем дозы составляет 0,5-1,0 мл во флаконе, Изобретение позволяет применить иммуногенную композицию, содержащую штамм рекомбинантной псевдоаденовирусной частицы, экспрессирующий химерный ген MBL-CT666 Chlamydia trachomatis, в качестве прайм-компонента вакцины против хламидиоза для защиты от урогенитального хламидиоза человека. 4 н.п. ф-лы, 11 ил., 2 табл., 7 пр. Подробнее
Дата
2019-09-26
Патентообладатели
федеральное государственное бюджетное учреждение «Национальный исследовательский центр эпидемиологии и микробиологии имени почетного академика Н.Ф. Гамалеи» Министерства здравоохранения Российской Федерации
Авторы
Шмаров Максим Михайлович , Щербинин Дмитрий Николаевич , Королева Екатерина Андреевна , Алексеева Светлана Викторовна , Довженко Нина Александровна , Зигангирова Наиля Ахатовна , Бондарева Наталья Евгеньевна
Реассортантный штамм вируса гриппа RN2/14-human A(H6N2) для определения антител к нейраминидазе при гриппозной инфекции и вакцинации / RU 02716416 C1 20200311/
Открыть
Описание
Изобретение относится к области биотехнологии. Изобретение представляет собой штамм RN2/14-human A(H6N2) активно размножающийся в развивающихся куриных эмбрионах при оптимальной температуре 33°С, что позволяет накапливать вирусный материал для последующей очистки и концентрации. Реассортант унаследовал ген, кодирующий поверхностный антиген вируса гемагглютинин (НА) и шесть генов, кодирующих внутренние и неструктурные белки, от A/17/серебристая чайка/Сарма/06/887 (H6N1), а ген, кодирующий поверхностный антиген вируса нейраминидазу (NA), от А/17/Гонконг/2014/8296 (H3N2). Штамм RN2/14-human A(H6N2) может применяться для выявления антител к нейраминидазе N2 вируса гриппа в сыворотках крови с использованием твердофазной реакции ингибирования нейраминидазной активности. 4 ил. Подробнее
Дата
2019-09-24
Патентообладатели
"Федеральное государственное бюджетное научное учреждение ""Институт экспериментальной медицины"" "
Авторы
Баженова Екатерина Андреевна , Руденко Лариса Георгиевна , Сычев Иван Александрович , Дешева Юлия Андреевна , Донина Светлана Александровна
Способ определения белков с помощью гигантского комбинационного рассеяния с использованием криозолей плазмонных наночастиц / RU 02717160 C1 20200318/
Открыть
Описание
Изобретение относится к области определения биомолекул с помощью эффекта гигантского комбинационного рассеяния (ГКР) и может быть использовано в медицинской диагностике для определения белков-маркеров различных патологий, в том числе с использованием технологии «лаборатория на чипе». Способ определения белков включает приготовление твердофазного ГКР-субстрата, представляющего собой каплю смеси золя плазмонных наночастиц с раствором содержащего белок анализируемого образца, замороженную на подложке из теплопроводного не имеющего собственного КР-спектра материала; воздействие на полученный субстрат лучом лазера при охлаждении ГКР-субстрата до температуры, обеспечивающей существование субстрата в твердом состоянии, запись ГКР-спектра и его матобработку. Технический результат состоит в повышении интенсивности и увеличении соотношения сигнал/шум получаемых спектров, в т.ч. в присутствии примесей, и в повышении стабильности получаемых результатов анализа во времени. 8 з.п. ф-лы, 7 ил. Подробнее
Дата
2019-09-19
Патентообладатели
Российская Федерация, от имени которой выступает ФОНД ПЕРСПЕКТИВНЫХ ИССЛЕДОВАНИЙ
Авторы
Курочкин Илья Николаевич , Еременко Аркадий Вениаминович , Дурманов Николай Николаевич , Моргунов Валерий Васильевич , Рыкова Валентина Александровна , Евтушенко Евгений Геннадьевич , Агафонов Павел Владимирович , Ковалев Александр Васильевич
Вакцинный штамм вируса гриппа А/17/СЛОВЕНИЯ/2015/1121 (H1N1)pdm09 для производства живой гриппозной интраназальной вакцины для взрослых и для детей / RU 02724706 C1 20200625/
Открыть
Описание
Изобретение относится к медицинской вирусологии. Вакцинный штамм А/17/Словения/2015/1121 (H1N1)pdm09 - реассортант, полученный путем скрещивания эпидемического вируса А/Словения/2903/2015 (HlNl)pdm09 с холодоадаптированным температурочувствительным вирусом А/Ленинград/134/17/57 (H2N2) - донором аттенуации, безвредным для людей. Штамм А/17/Словения/2015/1121 (H1N1)pdm09 активно размножается в развивающихся куриных эмбрионах при оптимальной температуре 32°С, характеризуется температурочувствительностью, холодоадаптированностью и безвредностью для лабораторных животных. Реассортант унаследовал гены, кодирующие поверхностные антигены вируса гемагглютинин (НА) и нейраминидазу (NA), от эпидемического родительского вируса и остальные шесть генов, кодирующих внутренние и неструктурные белки, от донора аттенуации. Штамм может быть использован в практическом здравоохранении для профилактики заболеваемости гриппом среди взрослых и детей. 5 табл. Подробнее
Дата
2019-09-02
Патентообладатели
"Федеральное государственное бюджетное научное учреждение ""Институт экспериментальной медицины"" "
Авторы
Баженова Екатерина Андреевна , Киселева Ирина Васильевна , Руденко Лариса Георгиевна , Исакова-Сивак Ирина Николаевна , Матюшенко Виктория Аркадьевна
Вакцинный штамм вируса гриппа А/17/БРИСБЕН/2017/7178 (H3N2) для производства живой гриппозной интраназальной вакцины для взрослых и для детей / RU 02711101 C1 20200115/
Открыть
Описание
Изобретение относится к области биотехнологии. Изобретение представляет собой штамм вируса гриппа А/17/Брисбен/2017/7178 (H3N2) - реассортант, полученный путем скрещивания эпидемического вируса А/Брисбен/190/2017 (H3N2) с холодоадаптированным температурочувствительным вирусом А/Ленинград/134/17/57 (H2N2) - донором аттенуации, безвредным для людей. Штамм А/17/Брисбен/2017/7178 (H3N2) активно размножается в развивающихся куриных эмбрионах при оптимальной температуре 32°С, характеризуется температурочувствительностью и холодоадаптированностью и безвредностью для лабораторных животных. Реассортант унаследовал гены, кодирующие поверхностные антигены вируса гемагглютинин (НА) и нейраминидазу (NA), от эпидемического родительского вируса и остальные шесть генов, кодирующие внутренние и неструктурные белки, от донора аттенуации. Изобретение позволяет осуществить профилактику заболеваемости гриппом среди взрослых и детей с помощью живой гриппозной интраназальной вакцины из штамма вируса гриппа А/17/Брисбен/2017/7178 (H3N2). 1 ил., 5 табл. Подробнее
Дата
2019-09-02
Патентообладатели
"Федеральное государственное бюджетное научное учреждение ""Институт экспериментальной медицины"" "
Авторы
Баженова Екатерина Андреевна , Киселева Ирина Васильевна , Крутикова Елена Витальевна , Степанова Екатерина Алексеевна , Ларионова Наталья Валентиновна , Руденко Лариса Георгиевна
СУПОВОЙ КОНЦЕНТРАТ ДЛЯ ДИЕТИЧЕСКОГО ПРОФИЛАКТИЧЕСКОГО ПИТАНИЯ / RU 02710077 C1 20191224/
Открыть
Описание
Изобретение относится к производству пищевых продуктов, в частности суповых концентратов в виде порошков или брикетов для приготовления блюд в домашних условиях, которые могут быть использованы в качестве диетического профилактического питания. Суповой концентрат для диетического профилактического питания содержит следующее количество исходных компонентов, мас. %: гидролизованный растительный белок 20,33-35,56; экстракт говядины 30,05-55,21; глутамат натрия 0,05-2,5; растительный жир 14,55-20,39; карамель 2,26-5,44; лимонную кислоту 1,63-2,78; любисток 5,58-10,53; экстракт боярышника 0,11-0,31; дигидрокверцетин 0,05-0,21; витамин С 0,11-0,36. Суповой концентрат обогащен витаминами и обладает высокими органолептическими показателями. Компоненты, входящие в состав супового концентрата, оказывают профилактическое воздействие на органы сердечно-сосудистой и пищеварительной систем, в том числе сердце и печень. 1 табл. Подробнее
Дата
2019-08-28
Патентообладатели
Афанасьев Александр Михайлович
Авторы
Афанасьев Александр Михайлович
СУПОВОЙ КОНЦЕНТРАТ ДЛЯ ДИЕТИЧЕСКОГО ПРОФИЛАКТИЧЕСКОГО ПИТАНИЯ / RU 02710078 C1 20191224/
Открыть
Описание
Изобретение относится к производству пищевых продуктов, в частности суповых концентратов в виде порошков или брикетов для приготовления блюд в домашних условиях, которые могут быть использованы в качестве диетического профилактического питания. Суповой концентрат для диетического профилактического питания содержит гидролизованный растительный белок, экстракт говядины, глутамат натрия, растительный жир, карамель, лимонную кислоту, любисток, экстракт расторопши и витамин Е при следующем содержании исходных компонентов, мас. %: гидролизованный растительный белок - 20,33-35,56; экстракт говядины - 30,05-55,21; глутамат натрия - 0,05-2,50; растительный жир - 14,55-20,39; карамель - 2,26-5,44; лимонная кислота - 1,63-2,78; любисток - 5,58-10,53; экстракт расторопши - 0,34-0,54; витамин Е - 0,05-0,21. Компоненты, входящие в состав супового концентрата, оказывают профилактическое воздействие на пищеварительную систему, в том числе печень, а также на сердечно-сосудистую систему. Суповой концентрат обладает высокими органолептическими показателями. 1 табл. Подробнее
Дата
2019-08-28
Патентообладатели
Афанасьев Александр Михайлович
Авторы
Афанасьев Александр Михайлович
Способ производства сывороточного изолята для изготовления адаптированных молочных смесей и заменителей грудного молока / RU 02713275 C1 20200204/
Открыть
Описание
Изобретение относится к молочной промышленности. Способ предусматривает электронно-лучевую обработку импульсным наносекундным пучком электронов плотностью 30-45 кГр на кромке, что соответствует поглощенной дозе 8-9 кГр в усредненном потоке, обезжиренной смеси коровьего молока и коровьего молозива, состоящего из 90% коровьего молока и 10% коровьего молозива или из 85% коровьего молока и 15% коровьего молозива, предварительно пропущенной через бактофугу и прошедшей «холодную сепарацию» при температуре до 30°С. После облучения смесь направляют на фильтрацию сначала через мембрану 800 нм, затем через мембраны с ситами 20 нм, где происходит разделение на пермеат и казеиновый ретентат. Затем пермеат направляют на фильтрацию с двумя ситами в 3 нм и проводят диафильтрацию для удаления солей и лактозы. После чего проводят процесс предварительного сгущения концентрированного сывороточного изолята до 70-80% на вакуумно-выпарных установках при температуре ниже 40єС, далее проводят спреевую сушку. Изобретение позволяет сохранить сывороточные белки в нативной форме, обеспечить полную элиминацию патогенной флоры и увеличить содержание сывороточных белков в продукте. 7 ил., 4 табл., 1 пр. Подробнее
Дата
2019-08-20
Патентообладатели
"Общество с ограниченной ответственностью ""Победа-1"" "
Авторы
Алексеев Дмитрий Станиславович , Бешлый Ярослав Владимирович , Бурачевский Николай Викторович , Казимировских Алиса Игоревна , Кривоногова Анна Сергеевна , Лоретц Ольга Геннадьевна , Майзель Сергей Гершевич , Пехотин Игорь Юрьевич , Соковнин Сергей Юрьевич
Моноклональное антитело к БТШ70 / RU 02722398 C1 20200529/
Открыть
Описание
Изобретение относится к области биохимии, в частности к моноклональному антителу, распознающему связанный с мембраной белок теплового шока 70. Изобретение обладает способностью эффективно лечить опухолевые заболевания. 1 з.п. ф-лы, 5 ил., 1 табл., 6 пр. Подробнее
Дата
2019-08-09
Патентообладатели
Федеральное государственное унитарное предприятие «Государственный научно-исследовательский институт особо чистых биопрепаратов» Федерального медико-биологического агентства
Авторы
Родин Сергей Владимирович , Ищенко Александр Митрофанович , Трофимов Александр Викторович , Горбунов Николай Петрович , Жахов Александр Владимирович , Василишина Анастасия Анатольевна , Гужова Ирина Владимировна , Маргулис Борис Александрович
СПОСОБ ТОРМОЖЕНИЯ РОСТА ПОДКОЖНОГО ТРАНСПЛАНТАТА ЭКСПЕРИМЕНТАЛЬНОЙ ГЛИОБЛАСТОМЫ ЧЕЛОВЕКА U-87, ПЕРЕВИТОГО ИММУНОДЕФИЦИТНЫМ МЫШАМ NU/J / RU 02717218 C1 20200318/
Открыть
Описание
Изобретение относится к медицине, а именно к онкологии и молекулярной биологии, и может быть использовано для торможения роста подкожного трансплантата экспериментальной глиобластомы человека U-87, перевитого иммунодефицитным мышам Nu/J. Мышам с подкожно перевитым графтом U-87 вводят протестированный на первом этапе препарат GcMAF RF© в дозе 1-2 мкг/мышь ежедневно, чередуя интраперитонеальные и интратуморальные инъекции, в течение 22 дней. Предшественник GcMAF RF© молекулы, витамин Д3 связывающий белок – DBP, выделяют из белка плазмы крови человека и конвертируют в GcMAF RF© дегликозилированием с использованием двух ферментов гликозилаз - сиалидазы и β-галактозидазы. На первом этапе проводят оценку способности GcMAF RF© активировать адаптивное звено противоракового иммунного ответа. На втором этапе оценивают специфическую противораковую активность обработанных GcMAF RF© макрофагов. Затем проводят биологический тест на способность тормозить рост экспериментальной глиобластомы человека. Способ обеспечивает расширение арсенала технических средств, которые направлены на торможение развития глиобластомы, и, в частности, на повышение эффективности торможения роста подкожного трансплантата экспериментальной перевиваемой культуры клеток глиобластомы человека U-87, перевитого (развивающегося в форме злокачественной опухоли) иммунодефицитным мышам Nu/J (модельным животным, у которых глиобластома U-87 формирует раковую опухоль), за счет инъекций активирующего макрофаги фактора GcMAF RF©. 4 з.п. ф-лы, 5 ил., 2 табл. Подробнее
Дата
2019-08-07
Патентообладатели
Зайцева Инга Николаевна , Богачев Сергей Станиславович
Авторы
Богачев Сергей Станиславович , Долгова Евгения Владимировна , Поттер Екатерина Анатольевна , Проскурина Анастасия Сергеевна , Риттер Генрих Сергеевич , Ефремов Ярослав Рейнгольдович , Кисаретова Полина Эдуардовна , Таранов Олег Святославович , Кирикович Светлана Сергеевна , Левитес Евгений Владимирович , Останин Александр Анатольевич , Черных Елена Рэмовна , Байбородин Сергей Иванович , Леплина Ольга Юрьевна
"Способ прогнозирования эффективного лечения рофлумиластом больных хронической обструктивной болезнью легких фенотипа ""с частыми обострениями""" / RU 02712244 C1 20200127/
Открыть
Описание
Изобретение относится к области медицины и представляет собой способ прогнозирования эффективного лечения рофлумиластом больных ХОБЛ фенотипа «с частыми обострениями», включающий до начала лечения рофлумиластом оценку качества жизни пациента по САТ-тесту, забор крови для определения в сыворотке крови уровня биомаркеров системного воспаления - С-реактивного белка (СРБ) и интерлейкина-6 (IL-6), а затем решают дискриминантное уравнение: ! Д=8,44-0,20*(САТ)-0,39*(СРБ)-0,12*(IL-6), ! где CAT - COPD Assessment Test - в баллах, СРБ - С-реактивный белок в мг/л, IL-6 - интерлейкин-6 в пг/л, при этом при величине Д более 1,36 прогнозируют эффективное лечение рофлумиластом в течение 12-ти месяцев в комбинации с препаратами базисной терапии, а при величине Д менее и равной 1,36 эффективное лечение рофлумиластом в течение 12-ти месяцев в комбинации с препаратами базисной терапии не прогнозируют. Изобретение обеспечивает простой и быстрый в исполнении способ, обеспечивающий точность прогноза 93,3%. 2 пр. Подробнее
Дата
2019-07-31
Патентообладатели
"Федеральное государственное бюджетное образовательное учреждение высшего образования ""Амурская государственная медицинская академия"" Министерства здравоохранения Российской Федерации "
Авторы
Кулик Екатерина Геннадьевна , Павленко Валентина Ивановна , Нарышкина Светлана Владимировна
Конфета трехслойная / RU 02706943 C1 20191121/
Открыть
Описание
Изобретение относится к кондитерской промышленности и может быть использовано для приготовления трёхслойных конфет на основе сбивных и желейных масс. Предложена конфета трёхслойная, представляющая собой отформованный корпус, содержащий слой, выполненный из желейной конфетной массы, и второй слой, выполненный из сбивной конфетной массы, при этом рецептурный состав желейной конфетной массы содержит сахар-песок, патоку, агар, кислоту лимонную, а рецептурный состав сбивной конфетной массы содержит агаро-сахаро-паточный сироп, яичный белок, молочный компонент, сливочное масло, причем корпус дополнительно содержит третий слой, выполненный из сбивной конфетной массы, рецептурный состав которой дополнительно содержит заменитель молочного жира, концентрат молочного белка «Сгущённое молоко», в качестве молочного компонента содержит сгущённое с сахаром молоко, а в качестве яичного белка - водный раствор яичного белка сухого и представляет собой сливочное суфле белого цвета, а рецептурный состав сбивной конфетной массы, для выполнения второго слоя корпуса, дополнительно содержит заменитель молочного жира, краситель натуральный «Кармин» и ароматизатор «Клюква», в качестве молочного компонента содержит сгущённое с сахаром молоко, а в качестве яичного белка - раствор яичного белка сухого и представляет собой сливочное суфле розового цвета, при этом желейная конфетная масса, для выполнения первого слоя корпуса, дополнительно содержит ароматизатор «Клюква» и воду, а в качестве кислоты лимонной - 50% водный раствор лимонной кислоты, причем исходные компоненты используют в заданном соотношении. Корпус конфеты, состоящий из слоёв, выполненных из сливочного суфле белого цвета, сливочного суфле розового цвета и желейной конфетной массы содержит слои в следующем соотношении в мас.%: слой из желейной конфетной массы 10–14; слой из сливочного суфле розового цвета 43–45; слой из сливочного суфле белого цвета 43–45. При этом дно третьего слоя корпуса содержит покрытие из шоколадной глазури в количестве 8-9 мас.% от общего количества массы корпуса. Изобретение направлено на улучшение органолептических свойств в части вкуса и цвета. 3 з.п. ф-лы, 4 табл., 3 пр. Подробнее
Дата
2019-07-16
Патентообладатели
Иванова Татьяна Валерьевна
Авторы
Иванова Татьяна Валерьевна
Рекомбинантный белок для иммунизации против холеры / RU 02723705 C1 20200617/
Открыть
Описание
Изобретение относится к биотехнологии и представляет собой рекомбинантный белок, содержащий последовательности фактора вирулентности TcpA и субъединицы В холерного токсина Vibrio cholerae, тиоредоксина А Escherichia coli и фрагмента Fc иммуноглобулина G1 человека. Также предложена последовательность ДНК, кодирующая этот белок. Изобретение показывает, что иммунизация мышей рекомбинантным белком приводит к индукции антител к белкам V.cholerae TcpA и СТВ в высоких титрах и вызывает защитный иммунитет на уровне рекомендованного к применению препарата вакцины от холеры. 2 н.п. ф-лы, 3 ил., 4 табл., 6 пр. Подробнее
Дата
2019-07-15
Патентообладатели
Федеральное государственное унитарное предприятие «Государственный научно-исследовательский институт особо чистых биопрепаратов» Федерального медико-биологического агентства
Авторы
Симбирцев Андрей Семенович , Протасов Евгений Александрович , Синева Светлана Адамовна , Трофимов Александр Викторович , Жахов Александр Владимирович , Мартюшин Сергей Васильевич , Антипова Татьяна Олеговна , Андоскин Павел Александрович , Горбунова Ирина Николаевна , Захаров Михаил Сергеевич , Свентицкий Евгений Николаевич , Торопов Дмитрий Кириллович , Певнева Анастасия Андреевна , Митрофанов Евгений Витальевич
Рекомбинантная плазмидная ДНК pQE-30_P36GP12_GP57, обеспечивающая синтез рекомбинантного белка P36GP12 в клетках Escherichia coli, штамм бактерий Escherichia coli - продуцент рекомбинантного белка P36GP12, рекомбинантный белок P36GP12, обладающий способностью связывать липополисахариды Escherichia coli / RU 02707922 C1 20191202/
Открыть
Описание
Изобретение относится к области биотехнологии, конкретно к рекомбинантному получению в клетках Escherichia coli гибридного белка, и может быть использовано для очистки биотехнологических субстанций от бактериальных липополисахаридов. Получают гибридный белок P36GP12, состоящий из N-концевого олигопептида MRGSHHHHHHGSAN и полноразмерного белка коротких хвостовых нитей изолята Т4-подобного бактериофага. Сконструирована плазмида pQE-30_P36GP12_GP57, обеспечивающая синтез рекомбинантного белка P36GP12 в клетках штамма Escherichia coli DH5αF'/pQE-30_P36GP12_GP57, полученного трансформацией клеток Escherichia coli DH5αF' сконструированной плазмидой. Изобретение позволяет получить рекомбинантный белок P36GP12, обладающий способностью связывать липополисахариды Escherichia coli. 3 н.п. ф-лы, 6 ил., 6 пр. Подробнее
Дата
2019-06-27
Патентообладатели
Федеральное государственное бюджетное учреждение науки Институт химической биологии и фундаментальной медицины Сибирского отделения Российской академии наук
Авторы
Боковая Ольга Васильевна , Байков Иван Константинович , Морозова Вера Витальевна , Козлова Юлия Николаевна , Тикунова Нина Викторовна
Способ изготовления йодированных молочных сывороточных белков для получения биологически активного вещества / RU 02700444 C1 20190917/
Открыть
Описание
Изобретение относится к области изготовления йодированных молочных сывороточных белков для получения биологически активного вещества и может быть использовано для профилактики йододефицитных состояний человека и животных. Осуществляют процесс йодирования исходного белкового сырья, в качестве которого используют α-лактальбумин, β-лактоглобулин или смесь перечисленных белков, или гидролизаты перечисленных белков, смешиванием с водным раствором неорганического йода при температуре 20-40°C и при соотношении раствора неорганического йода к общему белку, выбранном (2-40):1. Ферментируют смесь сывороточных белков с водным раствором неорганического йода путем введения в нее буферной смеси реагентов - комплекса минеральных солей NaCl и фосфатов Na и K и смеси ферментов на основе лактопероксидазы, содержащей от 16 до 24 мас. %, пероксидазы хрена и от 14 до 21 мас. % каталазы. Буферная смесь содержит 14-18 мас. % фосфата натрия и 22-28 мас. % ортофосфата калия при стабильности рН=6-8 реакционной смесью ферментов, иммобилизованных на полупроницаемых мембранах или на инертных носителях. Процесс ферментации проводят при непрерывном контроле содержания йода в растворе. Водный раствор йодированных белков очищают от макропримесей и микропримесей, в том числе и от неорганического йода, с использованием макрофильтрации, микрофильтрации с последующей диафильтрацией водного раствора йодированных белков на ультрафильтрационной установке в тангенциальном проточном режиме с использованием мембранных модулей с пределом отсечения от 300 до 800 Да при рН 6,0-8,0. Полученный раствор йодированных белков подвергают стерилизующей микрофильтрации, затем сублимационной или распылительной сушке с получением готового порошкового продукта с содержанием детерминированного ковалентно связанного йода в количестве 0,5-4% в форме содержащейся в йодированных белках смеси йодированных аминокислот - монойодтирозинов в количестве 55-75 мас. %, 24,0-43,5 мас. % дийодтирозинов и с 1,0-1,5 мас. % трийодтирозинов. Изобретение обеспечивает получение готового порошкового продукта с заданным содержанием детерминированного количества ковалентно связанного йода с оптимальным и заданным содержанием в нем йодированных аминокислот – монойодтирозинов, дийодтирозинов и трийодтирозинов, получение промышленных объемов йодированных молочных сывороточных белков. 6 пр. Подробнее
Дата
2019-06-14
Патентообладатели
Федоров Александр Анатольевич , Дю Феликс Чименович , Люблинская Ирина Николаевна , Люблинский Станислав Людвигович
Авторы
Федоров Александр Анатольевич , Дю Феликс Чименович , Люблинская Ирина Николаевна , Люблинский Станислав Людвигович